Choose the Protein | Translation command to open the Translation Parameters dialog box. You may choose necessary options to display translation results.
1) Amino Acid symbol
You may select One letter or Three letter code for amino acids.
2) Reading Frame
You may choose Reading Frame 1, Frame 2 and Frame 3..
You may also choose the All option to translate the DNA sequence in all six reading frames (including three frames of the minus strand).
3) Annotations
If there are annotations in the sequence, you have the options to deal with them.
4) AA per line
You may define the number of amino acids of each line in the output result.
5) Show DNA
DNAMAN may show Single strand or Double starnd DNA sequence together with amino acid sequences. You may also choose not showing DNA sequence.
6) Resulting AA sequences to channel option
If further analysis of amino acid sequences is required, you may direct the amino acid sequences to channels.
If IUPAC code resent in the default DNA sequence and the coding amino acid is undefined, “X” may appear in that position.
DNAMAN can translate a part of the default DNA sequence to amino acid sequence. You may define the analysis region, such as an open reading frame, for translation. Choose the Sequence | Current Channel | Analysis Definition command to specify the region you want to analyze. Then choose the translation command to display the results.
1 CTAAAGAAACATCTGAGGTGGTTAAAAGCTCTCCCTCGTGTCACCCCCTTTTATGCAGTCAAATGTAATGATAGCAAAGCCAAGACGAAG
91 ACGAGAGAATGACAAAACACTCATGTATTACGGGAATGATGGTGTCTATGGATCGTTCAATTGCATCTTGTATGATCATGCACATGTTAA
1 M T K H S C I T G M M V S M D R S I A S C M I M H M L N
181 ACCAGTTCTGCAAAAGCGGCCTAAACCAGATGACGGCTGCTACTCCTGCAGCATATGGGGCAACGGATTCCAGAGGCCAACAATACATTA
29 Q F C K S G L N Q M T A A T P A A Y G A T D S R G Q Q Y I M
271 TGCGATGCTCCTGTGCCTGTGAAAGTGGAATTGAGTATCCAGCAACTTGTGCTTCAGCTAGTATTAATGTATAAATAATAAATACTTAGA
59 R C S C A C E S G I E Y P A T C A S A S I N V *
361 AACTAACTGCAAGTTTAGTCATTGAATTTAGGGCATTTGGGGGACCATTAACTTAATTCTTGCTAGAATTTTTTAAGTGTTTTTTTAAAA
451 GTTTAGGTTTGGCATAAACACGACAAAAAA
The above example shows a DNA sequence and the translated amino acid sequence. There are three methods for further analysis of the protein sequences. In the Translation Parameters dialog box: